Skip to main content

Table 3 Primers used for RT-PCR

From: Proteomics identifies differentially expressed proteins in neonatal murine thymus compared with adults

Gene name Primer sequence (5'-3') Amplicon size (bp)
Tnc fwd: AGCCACCCGCTACTACAT rev: CTGCACCTGAACGACAAA 193
Atp5b fwd: AGATTCTGGTGACTGGGATA rev: TGGCGACATTGTTGATTAG 132
Actn4 fwd: GTTTGCCTAAGCCAGAGC rev: ATCATTCCCAGGGTCATC 154
Actb fwd: ATCGTGCGTGACATCAAA rev: AGAAGGAAGGCTGGAAAA 178
Hspd1 fwd: GGGGAAGTCCCAAAGTAA rev: CCTTGGCAATAGATCGTG 174
Hspa9 fwd: CAAAGGTCCTGGAGAATG rev: CAATAAGACGCTTAGTAGCA 150
Trap1 fwd: AGACGGACGCACCACTCA rev: CAGCCACTTGGGCAGGAT 158
Sept7 fwd: GTGAATCTGGACTGGGAAAG rev: CAGCAGCAACTGAACACCAC 158
Stoml2 fwd: GGGCTCTGACTCAACATAAT rev: GATTGGAGGGCAGTAGCA 117
Cfl1 fwd: TGCCGCTATGCACTCTAT rev: GGTCCTTGACCTCCTCGT 199
Cotl1 fwd: AAGTTTGCCCTCATCACA rev: ACTGAGCGTCGTAGTTGG 199
Psme1 fwd: AGGAGGAGCGGAAGAAGC rev: AACCAGGTAGTGACCAGATTGA 184
Gapdh fwd: CCTTCCGTGTTCCTACCC rev: AAGTCGCAGGAGACAACC 163