Proteomic analysis of PBMCs: characterization of potential HIV-associated proteins

Table 2 Quantitative analysis results of mRNA expression of 10 differentially expressed proteins in PBMCs from HIV-positive patients and healthy donors.

gene name	strand	primer	Aaymp. Sig.(2-tailed)	Number (HIV/Normal)	Mean peak (HIV/Normal)	Expression of proteins in HIV
KPYM	sense	ctatcctctggaggctgtgc	0.029	10/10	0.6	↑11.9
	antisense	ccagacttggtgaggacgat
TLN1	sense	tctcccaaaatgccaagaac	0.022	20/22	1.5	↑4.1
	antisense	ctccactagcccttgctgtc
CAP1	sense	gtgtcaacagccagcagaaa	0.004	10/10	0.8	Only
	antisense	gcggcatcattcatttcttt
ENOA	sense	gagctccgggacaatgataa	0.631	10/10	1.1	Only
	antisense	tgttccatccatctcgatca
EHD3	sense	ctaaccctgtgctggagagc	0.009	10/10	0.8	Only
	antisense	gtcagctttgttcagcacca
COR1C	sense	gcagaagagtggttcgaagg	0.047	20/22	1.4	↑2.0
	antisense	tgatcaggtcgcacttcttg
ST1A3	sense	catgaaggagaaccccaaaa	0.739	10/10	1.1	↑1.8
	antisense	tgaaggtggtcttccagtcc
FLNA	sense	aagtgaccgccaataacgac	0.393	10/10	0.8	↑1.7
	antisense	ggcgtcaccctgtgacttat
VINC	sense	gccaagcagtgcacagataa	0.007	20/22	1.6	↑14.1
	antisense	tctttctaacccagcgcagt
GNB1	sense	cttgtgatgcttcagccaaa	0.078	20/22	1.4	↓1.5
	antisense	tcagcacgaaggtcaaacag

Isolated PBMCs from HIV-positive and healthy donors were treated with Trizol regent and RNA was extracted according to the manufacturer's instructions. The primers were obtained through primer 3.0 software analysis. The data were statistic analyzed through Mann-Whitney test.

ISSN: 1477-5956