Skip to main content

Table 4 The primers used for verification of the differentially expressed genes

From: Effects of the complete replacement of fish oil with linseed oil on growth, fatty acid composition, and protein expression in the Chinese mitten crab (Eriocheir sinensis)

Gene name Primer sequence (5′ → 3′) Product length (bp)
HSP70-F CTACACCTCCATCACCCGT 105
HSP70-R TTGTCCATCTTGGCATCAC
Tpi-F AGGTTGTGGTGGGATGTC 178
Tpi-R TCTGAGTGTCCAAGGATGA
AM-F TCAAGGACGACCTCAAGAA 132
AM-R CCCTCAGCCGAAGACAC
Cyc-F GGAGGCACAGAAAGAAGC 129
Cyc-R TAGACGAGAACCGAACGC
HS6-F AGCCCAGATGACCCAAACTC 214
HS6-R CTGATGGTGGACCCAGAAGA
Cat-F CCAAAGGTCTTACTTCGCC 140
Cat-R CCGTGGTTTTATTGCCAA
18S-F TCCAGTTCGCAGCTTCTTCTT 90
18S-R AACATCTAAGGGCATCACAGA
  1. HSP70 heat shock protein 70, Tpi triosephosphate isomerase, AM alpha 2-macroglobulin, Cyc cyclophilin A, HS6: hemocyanin subunit 6, Cat cathepsin C, 18S 18S ribosomal RNA