Skip to main content

Table 1 Primers for qPCR

From: Calcitonin gene-related peptide promotes proliferation and inhibits apoptosis in endothelial progenitor cells via inhibiting MAPK signaling

Gene Sequence Length (bp) Accession number
cyclin D1 TGAAGTTCATTTCCAACCCA 150 bp NM_171992.4
AGTCCGGGTCACACTTG
cyclin E GACACAGCTTCGGGTCTG 137 bp NM_001100821.1
TTTGCCTTCCTTTTTCTGGA
Caspase 3 CTGGACTGCGGTATTGAGAC 104 bp XM_006253130.2
CATGGGATCTGTTTCTTTGC
Bcl-2 TGTGGCCTTCTTTGAGTTCG 149 bp NM_016993.1
CATCCCAGCCTCCGTTATCC
Bax TGCTACAGGGTTTCATCCAGG 114 bp NM_017059.2
TGAGACACTCGCTCAGCTTCTTG
caspase 8 CCTATGCCACCTAGTGATTA 94 bp NM_022277.1
TATAAAACACCGGAGGTCAG
caspase 9 CTGCGTCTCATCAAAGTTTC 90 bp NM_031632.1
GACAGTCCTTTTGCCTAAGA