Skip to main content

Table 1 The primers for qRT-PCR

From: Proteomic analysis of early salt stress responsive proteins in alfalfa roots and shoots

Protein Genes Primers Sequence
Actin gi|378407816 Forward primer(5′-3′) GATACTCTTTCACCACAACAGCCG
   Reverse primer(5′-3′) ACTTCAGGACAACGGAAACGCT
CP12 gi|3,123,345 Forward primer(5′-3′) TGGCAACAATAGGTGGTCT
   Reverse primer(5′-3′) CTCGTCGGTTTCAGGGT
HI protein gi|283,831,548 Forward primer(5′-3′) GCTGATGAAATCGTCCCA
   Reverse primer(5′-3′) ACCCTGTTCCTCCCACTAAGCTGTA
PR protein 2 gi|44,887,779 Forward primer(5′-3′) CTAAATTACCAGCATCAACGC
   Reverse primer(5′-3′) CCTCTACTTTCATCAGGGACAA
IOMT gi|22,266,001 Forward primer(5′-3′) GCTGATGAAATCGTCCCA
   Reverse primer(5′-3′) AACCCTGTTCCTCCTACCA