Skip to main content

Table 1 DNA primers for RT-qPCR used in this study

From: Proteome modifications on tomato under extreme high light induced-stress

Gene Forward primer Reverse primer PCR product size (bp) Source
psb28 CCTCGCTCTCTTCTCGGAAT GCAAAACGCGAACGGGATAG 98 This study
psbS GGAATTGGCTTCACTAAGCA AGTGGCTCTGCTTCATAGAT 155 This study
psbH TCTGGTCCAAGACGAACTGC CAAAGGGGTAGTTCCCCACC 93 This study
psbR CAGGAAGCCCAAGGGAAAGG GTCACCGCCCATATGGCTAA 153 This study
TPP2Acs CGATGTGTGATCTCCTATGGTC AAGCTGATGGGCTCTAGAAATC 149 Løvdal and Lillo, 2009
clat ATGCAATCACACCAGCAC ACTCAGCACAACAACAAAGG 61 Dekkers et al., 2012